EnhancerDB
  1. Home
  2. TFBS
  3. MEF2D[chr5:78124049-78124061]
Chromosome characteristics of MEF2D[chr5:78124049-78124061]
Back to top
Enhancers possibly regulated by MEF2D[chr5:78124049-78124061]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 78112545 78131455 enh48959
Blood (GM12878) Thyroid Peripheral Blood (MM.1S) Muscle (Myoblast) Uterus Thymus Epithelial (MCF-7)
SNP sites on MEF2D[chr5:78124049-78124061]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 78124049 rs142881617 GTGTATTTTTAAAAATTTTGAGCTTTTC G 8329491
chr5 78124049 rs376175593 GTGTATTTTTAAAAATTTTGAGCTTTTC G 8329492
Genes possibly regulated by MEF2D[chr5:78124049-78124061]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MEF2D[chr5:78124049-78124061]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results