Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 78112545 78131455 enh48959

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 78124049 rs142881617 GTGTATTTTTAAAAATTTTGAGCTTTTC G 8329491
chr5 78124049 rs376175593 GTGTATTTTTAAAAATTTTGAGCTTTTC G 8329492

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results