Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 78475185 78482895 enh22386

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 78480609 rs528939471 GTGTAATCCCAGCTACCCAGC G 8330934

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results