Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 79590045 79594195 enh100369

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 79591567 rs564954681 C CCTCAGCCTCCTGCGATTATCCCAT 8337653
chr5 79591567 rs568203815 C T 8337654

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results