Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 93359565 93365855 enh55379

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 93365286 rs537194445 G GTTGCATCACATCAGAAAACACACAATGT 8381918

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results