Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 151308161 151313914 enh70901

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 151310009 rs67454867 TACACACACACACACACACAC T 7113809
chr3 151310009 rs9289850 TACACACACACACACACACAC T 7113810

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results