Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 148204845 148231275 enh8783

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 148227876 rs536134901 C T 8603298
chr5 148227876 rs565617716 C CTTCCGTCCTTCCTTCCTTCCTTCT 8603299

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results