Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 150988713 151010455 enh38517

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 151003654 rs142962432 CTAAAAATAAAAACTTTTTT C 8621443
chr5 151003654 rs374251254 CTAAAAATAAAAACTTTTTT C 8621444

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results