Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 151095152 151111455 enh22735

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 151098075 rs72800261 T G 8622410
chr5 151098077 rs374720417 C CATTTCTGAAGAAGAAATCCATTTTCTT 8622411

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results