Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 153449945 153460135 enh22741

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 153452829 rs576626421 ACATTTGTATGTAGAAGTACAGTG A 8627566

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results