Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 153586145 153597465 enh38531

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 153594084 rs143242243 TGCTTCCTTTTTTAAACTTAAAAAA T 8628551
chr5 153594084 rs749789044 TGCTTCCTTTTTTAAACTTAAAAAA T 8628552

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results