Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 153771905 153777802 enh72066

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 153776047 rs142597331 GGGTCCAGACCTTAGGAAAACACA G 8629912
chr5 153776047 rs199751887 GGGTCCAGACCTTAGGAAAACACA G 8629913

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results