Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 156867727 156878735 enh63484

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 156874318 rs374023632 AGGTGGGCGGCTGTGTCCCCGCCCT A 8641485
chr5 156874318 rs569603618 AGGTGGGCGGCTGTGTCCCCGCCCT A 8641486

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results