Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 157619115 157629435 enh8822

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 157624053 rs150019763 A ATTACCCAGCCTCAGGTATTCCT 8646586
chr5 157624053 rs78421618 A ATTACCCAGCCTCAGGTATTCCT 8646587

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results