Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 166816365 166821467 enh72106

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 166817002 rs568076096 ACAATGTCTACAGTGATCCCAGAT A 8673440

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results