EnhancerDB
  1. Home
  2. TFBS
  3. FOXC1[chr5:167073134-167073145]
Chromosome characteristics of FOXC1[chr5:167073134-167073145]
Back to top
Enhancers possibly regulated by FOXC1[chr5:167073134-167073145]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 167064305 167074032 enh38619
Skin (Keratinocyte) Prostate (PC-3) Brain (SK-N-MC) Prostate (RWPE1) Astrocyte Muscle (A673) Lung (PC-9) Muscle (Myoblast) Heart
SNP sites on FOXC1[chr5:167073134-167073145]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 167073141 rs180840270 T A 8674654
chr5 167073142 rs139410947 T TATATATATATGTTGTTTTC 8674655
Genes possibly regulated by FOXC1[chr5:167073134-167073145]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXC1[chr5:167073134-167073145]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results