Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 167094045 167100455 enh38621

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 167099175 rs562856725 AAACAAAAGACAATTTCATAAAAT A 8674856

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results