| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 168711705 | 168716295 | enh100447 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 168715581 | rs535394889 | G | T | 8685117 | |
| chr5 | 168715583 | rs555259535 | C | T | 8685118 | |
| chr5 | 168715586 | rs540128338 | G | GACTAACTTTGAAGTTAGTTTGAACTGTTCTAGTTACCAGAACATTTCAA | 8685119 | |
| chr5 | 168715586 | rs574866503 | G | A | 8685120 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|