EnhancerDB
  1. Home
  2. TFBS
  3. YY1[chr5:172195184-172195188]
Chromosome characteristics of YY1[chr5:172195184-172195188]
Back to top
Enhancers possibly regulated by YY1[chr5:172195184-172195188]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172182745 172195855 enh8880
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Lung (PC-9) Bone (Osteoblast) Muscle (A673) Placenta Colon (HCT116) Blood (Karpas-422) Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Thymus Stomach
SNP sites on YY1[chr5:172195184-172195188]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172195187 rs200042284 T TTTCAGGTCATAAATAATCAG 8704568
Genes possibly regulated by YY1[chr5:172195184-172195188]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 172195093 172198198 - DUSP1 ENSG00000120129.5 172198198 0.79 1.0 3010 5985
Expression level of Genes
Back to top
miRNAs possibly regulated by YY1[chr5:172195184-172195188]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results