Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172908552 172912975 enh59568

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172910856 rs35698431 GCATACTGCTAAAGGTGTGGCAGAGTAA G 8709844

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results