EnhancerDB
  1. Home
  2. TFBS
  3. TGIF2[chr5:174051270-174051282]
Chromosome characteristics of TGIF2[chr5:174051270-174051282]
Back to top
Enhancers possibly regulated by TGIF2[chr5:174051270-174051282]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 174033011 174055875 enh22842
Brain (SK-N-SH) Large Intestine Stomach Placenta Colon (HCT116) Peripheral Blood (MM.1S) Pancreas Epithelial (MCF-7)
SNP sites on TGIF2[chr5:174051270-174051282]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 174051280 rs145768702 G GCAGGGAAACGAGAATTAGCCATTGGA 8719522
chr5 174051280 rs369990488 G GCAGGGAAACGAGAATTAGCCATTGGA 8719523
chr5 174051280 rs375139736 G GCAGGGAAACGAGAATTAGCCATTGGA 8719524
Genes possibly regulated by TGIF2[chr5:174051270-174051282]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TGIF2[chr5:174051270-174051282]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results