Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 174994145 175005395 enh49013

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 175000643 rs548110864 CTGTAATTGAATTACATCCCATAAATTGGGA C 8724281

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results