Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 175835817 175842515 enh46033

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 175837747 rs142742411 AGAGGGGCCTACGCGTCTCTGCCTGTCCCT A 8727606
chr5 175837747 rs72248586 AGAGGGGCCTACGCGTCTCTGCCTGTCCCT A 8727607

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results