Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 178251209 178255587 enh59573

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 178253547 rs58448272 A AAAAAGGCTTAGATTCAATCTT 8740186
chr5 178253547 rs71587693 A AAAAAGGCTTAGATTCAATCTT 8740187

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results