Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 179030585 179044455 enh66152

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 179040000 rs146349763 A ATAACACCCCCCATGTTTGTCCGGTAGG 8745472
chr5 179040000 rs374415158 A ATAACACCCCCCATGTTTGTCCGGTAGG 8745473

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results