| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 179030585 | 179044455 | enh66152 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 179040000 | rs146349763 | A | ATAACACCCCCCATGTTTGTCCGGTAGG | 8745472 | |
| chr5 | 179040000 | rs374415158 | A | ATAACACCCCCCATGTTTGTCCGGTAGG | 8745473 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|