Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 1837465 1841615 enh100764
chr8 1837817 1838203 vista58030

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 1838154 rs562551693 TGTGAGCAATCTGTGAGGAGACACTGAGTGCG T 10228403
chr8 1838160 rs562400969 C G 10228404
chr8 1838161 rs531649510 A C 10228405

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results