| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr19 | 570285 | 574435 | enh99529 |
|
|
| chr19 | 573434 | 573573 | vista28093 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr19 | 573497 | rs547376405 | GTCTTGCCTAGGGCGTGCACCTGCCCCCGGGTGT | G | 5365420 | |
| chr19 | 573502 | rs575145394 | G | C | 5365421 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|