| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr3 | 181434130 | 181444165 | enh36198 |
|
|
| chr3 | 181440813 | 181441146 | vista43360 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr3 | 181441007 | rs370080271 | CAGGACAGTTCCCTCAGTGCCACCACTGCGGGCA | C | 7235288 | |
| chr3 | 181441007 | rs558825243 | CAGGACAGTTCCCTCAGTGCCACCACTGCGGGCA | C | 7235289 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|