Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 25631105 25648495 enh52993

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 25643336 rs200119164 AATCTATCTATCTATCTATCTATCTATCT A 5593887

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results