Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 28823805 28839255 enh18392

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 28823904 rs147764726 GCTTTGTTGCTGGGTACAGCGACA G 5609711
chr2 28823904 rs374301958 GCTTTGTTGCTGGGTACAGCGACA G 5609712

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results