| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 30501645 | 30518759 | enh5385 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 30511809 | rs367776073 | A | AGGGGGTAAGAGAGGTAATTGGGTGGACTAGGGT | 5619691 | |
| chr2 | 30511809 | rs376928557 | A | AGGGGGTAAGAGAGGTAATTGGGTGGACTAGGGT | 5619692 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|