Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 37932085 37942815 enh33226

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 37938082 rs112273957 GGCTGAGTAATGATCCCCCAAAGAT G 5654215
chr2 37938082 rs373499650 GGCTGAGTAATGATCCCCCAAAGAT G 5654216

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results