Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 38159449 38164795 enh60801

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 38162032 rs575249858 A AATTACAATATTATATGAAGC 5657019

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results