Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 39386325 39390475 enh109859

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 39388254 rs144097219 ATTTTGCAATTTGAAATTGAAG A 5666615
chr2 39388254 rs72377786 ATTTTGCAATTTGAAATTGAAG A 5666616

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results