Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 70579485 70603995 enh33426

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 70597436 rs142259900 TAACTAATGAGGAAAGGAGTAAGATAC T 5834838
chr2 70597436 rs68090402 TAACTAATGAGGAAAGGAGTAAGATAC T 5834839

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results