Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 70968905 70977792 enh69749

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 70969061 rs570411253 T TTAACCAATTTTGACATTTCTCTAATCAA 5837486

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results