EnhancerDB
  1. Home
  2. TFBS
  3. PROX1[chr2:72256713-72256725]
Chromosome characteristics of PROX1[chr2:72256713-72256725]
Back to top
Enhancers possibly regulated by PROX1[chr2:72256713-72256725]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 72256700 72271299 enh58919
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Colon (HCT116)
SNP sites on PROX1[chr2:72256713-72256725]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 72256717 rs377157719 GACATCTTGAAATATCAAAAACGCTCATCC G 5843736
chr2 72256717 rs574600001 GACATCTTGAAATATCAAAAACGCTCATCC G 5843737
Genes possibly regulated by PROX1[chr2:72256713-72256725]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PROX1[chr2:72256713-72256725]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results