Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 75653325 75662628 enh5661

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 75658867 rs35189064 C T 5857662
chr2 75658873 rs564842438 TAAAAGAATACTTGAGGCTGGGCA T 5857663

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results