Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 96864385 96872015 enh86362

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 96866900 rs539436502 GCATGTCCTGGTAAACATTA G 5899595

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results