Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 97410885 97420115 enh18735

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 97418607 rs552552880 C CATTT,CTATTT 5901215
chr2 97418607 rs566034246 CTATTTTATTTTATTTTATTTTATTT C 5901216

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results