EnhancerDB
  1. Home
  2. TFBS
  3. T[chr2:97438513-97438529]
Chromosome characteristics of T[chr2:97438513-97438529]
Back to top
Enhancers possibly regulated by T[chr2:97438513-97438529]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 97426265 97442177 enh5715
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Esophagus Lung (PC-9) Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Colon (HCT116) Thyroid Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Heart
SNP sites on T[chr2:97438513-97438529]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 97438524 rs566053515 A T 5901356
chr2 97438525 rs554540280 TGCGCACACACACACACACTCATACCC T 5901357
Genes possibly regulated by T[chr2:97438513-97438529]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by T[chr2:97438513-97438529]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results