Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 98355065 98371635 enh33501

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 98362417 rs528796882 CATGGAACATTATCCAGCTG C 5903249

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results