Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 102052809 102065725 enh33523

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 102062942 rs372826388 ATCAATTATTAAGTATATGC A 5919950
chr2 102062944 rs56125224 C G 5919951

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results