| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 120154365 | 120162875 | enh53268 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 120155393 | rs138907640 | CTAAGCCAGTGATGGAAAACAAAGACGGGGCACATCTGGCTAAGA | C | 5985547 | |
| chr2 | 120155393 | rs373709243 | CTAAGCCAGTGATGGAAAACAAAGACGGGGCACATCTGGCTAAGA | C | 5985548 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|