Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 120958765 120970195 enh44872

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 120960381 rs544104225 TGGGAGGCCAAGGCGGGCGGATCATGA T 5988318

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results