Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 122010425 122023655 enh18853

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 122014287 rs546110205 G GGTTGCAGTGAGGCAAGATGGCGTC 5998853

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results