Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 122049085 122053235 enh109893

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 122052039 rs58553892 GCTGGGCATGGTGGTGCACAC G 5999081
chr2 122052039 rs66467450 GCTGGGCATGGTGGTGCACAC G 5999082

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results