Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 122109945 122120567 enh33610

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 122111343 rs555377099 CCATAGTGTGCGTGTGCACATGCACGCACACA C 5999266

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results