| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 122527307 | 122538955 | enh33618 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 122527692 | rs140667760 | ATGTTTTAAAGGTTCATAACATACGTTAGTT | A | 6001543 | |
| chr2 | 122527692 | rs376120245 | ATGTTTTAAAGGTTCATAACATACGTTAGTT | A | 6001544 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|