EnhancerDB
  1. Home
  2. TFBS
  3. POU2F1[chr2:122527681-122527693]
Chromosome characteristics of POU2F1[chr2:122527681-122527693]
Back to top
Enhancers possibly regulated by POU2F1[chr2:122527681-122527693]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 122527307 122538955 enh33618
Large Intestine Astrocyte Blood (OCI-LY7) Muscle (Myotube) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on POU2F1[chr2:122527681-122527693]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 122527692 rs140667760 ATGTTTTAAAGGTTCATAACATACGTTAGTT A 6001543
chr2 122527692 rs376120245 ATGTTTTAAAGGTTCATAACATACGTTAGTT A 6001544
Genes possibly regulated by POU2F1[chr2:122527681-122527693]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU2F1[chr2:122527681-122527693]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results