EnhancerDB
  1. Home
  2. TFBS
  3. RUNX2[chr2:201142835-201142850]
Chromosome characteristics of RUNX2[chr2:201142835-201142850]
Back to top
Enhancers possibly regulated by RUNX2[chr2:201142835-201142850]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 201141246 201145989 enh59005
Esophagus Skin (Keratinocyte) Prostate (RWPE1)
SNP sites on RUNX2[chr2:201142835-201142850]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 201142846 rs565243461 T A 6289757
chr2 201142847 rs551061853 CTTCCTAGGTTGCCCCCAGCCA C 6289758
Genes possibly regulated by RUNX2[chr2:201142835-201142850]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RUNX2[chr2:201142835-201142850]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results